第四章基因的轉(zhuǎn)錄、后加工及逆轉(zhuǎn)錄transcription

1、 Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA.TranscriptionBoth processes use DNA as the template.Phosphodiester bonds are formed in both cases. Both synthesis directions are from 5 to 3. Similarity

2、 between replication and transcription replicationtranscriptiontemplatedouble strandssingle strandsubstratedNTPNTPprimer yesno EnzymeDNA polymeraseRNA polymeraseproductdsDNAssRNAbase pairA-T, G-CA-U, T-A, G-CDifferences between replication and transcriptionSection 1 Template and Enzymes The whole ge

3、nome of DNA needs to be replicated, but only small portion of genome is transcribed in response to the development requirement, physiological need and environmental changes. DNA regions that can be transcribed into RNA are called structural genes. 1.1 TemplateThe template strand is the strand from w

4、hich the RNA is actually transcribed. It is also termed as antisense strand.The coding strand is the strand whose base sequence specifies the amino acid sequence of the encoded protein. Therefore, it is also called as sense strand. Only the template strand is used for the transcription, but the codi

5、ng strand is not. Both strands can be used as the templates. The transcription direction on different strands is opposite. This feature is referred to as the asymmetric transcription. Asymmetric transcription template strandcoding strandtemplate strandcoding strand Organization of coding information

6、 in the adenovirus genome1.2 RNA PolymeraseThe enzyme responsible for the RNA synthesis is DNA-dependent RNA polymerase.The prokaryotic RNA polymerase is a multiple-subunit protein of 480kD. Eukaryotic systems have three kinds of RNA polymerases, each of which is a multiple-subunit protein and respo

7、nsible for transcription of different RNAs. HoloenzymeThe holoenzyme of RNA-pol in E.coli consists of 5 different subunits: 2 . subunitMWfunction36512Determine the DNA to be transcribed150618Catalyze polymerization155613Bind & open DNA template70263Recognize the promoterfor synthesis initiationRNA-p

8、ol of E. ColiRifampicin, a therapeutic drug for tuberculosis treatment, can bind specifically to the subunit of RNA-pol, and inhibit the RNA synthesis. RNA-pol of other prokaryotic systems is similar to that of E. coli in structure and functions. RNA-polIIIIII products45S rRNAhnRNA5S rRNAtRNA snRNAS

9、ensitivity to AmanitinNohighmoderateRNA-pol of eukaryotesAmanitin is a specific inhibitor of RNA-pol. Each transcriptable region is called operon.One operon includes several structural genes and upstream regulatory sequences (or regulatory regions). The promoter is the DNA sequence that RNA-pol can

10、bind. It is the key point for the transcription control. 1.3 Recognition of Origins Promoter Prokaryotic promoterConsensus sequenceConsensus SequenceFrequency in 45 samples 38 36 29 40 25 30 37 37 28 41 29 44 The -35 region of TTGACA sequence is the recognition site and the binding site of RNA-pol.T

11、he -10 region of TATAAT is the region at which a stable complex of DNA and RNA-pol is formed.Section 2 Transcription Process General conceptsThree phases: initiation, elongation, and termination. The prokaryotic RNA-pol can bind to the DNA template directly in the transcription process. The eukaryot

12、ic RNA-pol requires co-factors to bind to the DNA template together in the transcription process. 2.1 Transcription of ProkaryotesInitiation phase: RNA-pol recognizes the promoter and starts the transcription. Elongation phase: the RNA strand is continuously growing. Termination phase: the RNA-pol s

13、tops synthesis and the nascent RNA is separated from the DNA template. a. InitiationRNA-pol recognizes the TTGACA region, and slides to the TATAAT region, then opens the DNA duplex.The unwound region is about 171 bp. The first nucleotide on RNA transcript is always purine triphosphate. GTP is more o

14、ften than ATP. The pppGpN-OH structure remains on the RNA transcript until the RNA synthesis is completed. The three molecules form a transcription initiation complex. RNA-pol (2) - DNA - pppGpN- OH 3 No primer is needed for RNA synthesis. The subunit falls off from the RNA-pol once the first 3,5 ph

15、osphodiester bond is formed. The core enzyme moves along the DNA template to enter the elongation phase. b. ElongationThe release of the subunit causes the conformational change of the core enzyme. The core enzyme slides on the DNA template toward the 3 end. Free NTPs are added sequentially to the 3

16、 -OH of the nascent RNA strand. RNA-pol, DNA segment of 40nt and the nascent RNA form a complex called the transcription bubble. The 3 segment of the nascent RNA hybridizes with the DNA template, and its 5 end extends out the transcription bubble as the synthesis is processing. Transcription bubble

17、RNA-pol of E. Coli RNA-pol of E. Coli Simultaneous transcriptions and translationc. TerminationThe RNA-pol stops moving on the DNA template. The RNA transcript falls off from the transcription complex. The termination occurs in either -dependent or -independent manner. The termination function of fa

18、ctorThe factor, a hexamer, is a ATPase and a helicase. -independent terminationThe termination signal is a stretch of 30-40 nucleotides on the RNA transcript, consisting of many GC followed by a series of U. The sequence specificity of this nascent RNA transcript will form particular stem-loop struc

19、tures to terminate the transcription.RNA 5TTGCAGCCTGACAAATCAGGCTGATGGCTGGTGACTTTTTAGGCACCAGCCTTTTT. 3 DNA UUUU.rplL proteinUUUU. 5TTGCAGCCTGACAAATCAGGCTGATGGCTGGTGACTTTTTAGTCACCAGCCTTTTT. 3 The stem-loop structure alters the conformation of RNA-pol, leading to the pause of the RNA-pol moving.Then th

20、e competition of the RNA-RNA hybrid and the DNA-DNA hybrid reduces the DNA-RNA hybrid stability, and causes the transcription complex dissociated. Among all the base pairings, the most unstable one is rU:dA. Stem-loop disruption 2.2 Transcription of EukaryotesTranscription initiation needs promoter

21、and upstream regulatory regions. The cis-acting elements are the specific sequences on the DNA template that regulate the transcription of one or more genes. a. Initiation Cis-acting element TATA box RNA-pol does not bind the promoter directly. RNA-pol II associates with six transcription factors, T

22、FII A - TFII H. The trans-acting factors are the proteins that recognize and bind directly or indirectly cis-acting elements and regulate its activity.Transcription factors TF for eukaryotic transcription TBP of TFII D binds TATA TFII A and TFII B bind TFII DTFII F-RNA-pol complex binds TFII BTFII F

23、 and TFII E open the dsDNA (helicase and ATPase)TFII H: completion of PIC Pre-initiation complex (PIC) Pre-initiation complex (PIC)TBPTAFTF II H TF II H is of protein kinase activity to phosphorylate CTD of RNA-pol. (CTD is the C-terminal domain of RNA-pol) Only the p-RNA-pol can move toward the dow

24、nstream, starting the elongation phase.Most of the TFs fall off from PIC during the elongation phase. Phosphorylation of RNA-pol The elongation is similar to that of prokaryotes. The transcription and translation do not take place simultaneously since they are separated by nuclear membrane. b. Elong

25、ation RNA-PolRNA-PolRNA-Polnucleosomemoving direction The termination sequence is AATAAA followed by GT repeats. The termination is closely related to the post-transcriptional modification.c. Termination Section 3 Post-Transcriptional ModificationThe nascent RNA, also known as primary transcript, ne

26、eds to be modified to e functional tRNAs, rRNAs, and mRNAs. The modification is critical to eukaryotic systems. Primary transcripts of mRNA are called as heteronuclear RNA (hnRNA). hnRNA are larger than matured mRNA by many folds. Modification includes Capping at the 5- end Tailing at the 3- endmRNA

27、 splicingRNA edition 3.1 Modification of hnRNA a. Capping at the 5- endm7GpppGp- The 5- cap structure is found on hnRNA too. The capping process occurs in nuclei. The cap structure of mRNA will be recognized by the cap-binding protein required for translation. The capping occurs prior to the splicin

28、g. b. Poly-A tailing at 3 - endThere is no poly(dT) sequence on the DNA template. The tailing process dose not depend on the template. The tailing process occurs prior to the splicing.The tailing process takes place in the nuclei. The matured mRNAs are much shorter than the DNA templates. DNAmRNAc.

29、mRNA splicing The structural genes are composed of coding and non-coding regions that are alternatively separated. Split gene EABCDFG Exon and intronExons are the coding sequences that appear on split genes and primary transcripts, and will be expressed to matured mRNA.Introns are the non-coding seq

30、uences that are transcripted into primary mRNAs, and will be cleaved out in the later splicing process. mRNA splicingSplicing mechanism lariatTwice transesterificationTaking place at the transcription levelOne gene responsible for more than one proteinsSignificance: gene sequences, after post-transc

31、riptional modification, can be multiple purpose differentiation. d. mRNA editing Different pathway of apo B Human apo B genehnRNA (14 500 base)liverapo B100（500 kD）intestineapo B48（240 kD）CAA to UAAAt 66663.2 Modification of tRNAtRNA precursorRNA-pol IIITGGCNNAGTGCGGTTCGANNCCDNAPrecursor transcriptionRNAase Pendon